Search options (Page 9 of 135)

heck if i know

Hey i know you have a creative mind you think you could check out some Rpgs

Whats the evidence of God?

Just one cell is as intricate as a giant high-tech factory. On the outside there is a security system that only allows exactly the right goods in – the cell membrane. Elsewhere in the factory we see the power sources in the cell cytoplasm, which are accessed by the central memory bank – the cell nucleus. The nucleus stores and retrieves vast amounts of information, decoding artificial languages at bewildering speeds. Raw materials are directed along miles of corridors, and precision quality control mechanisms prevent any slip-ups. But then the cell does something no high-tech factory ever does. It reproduces itself within a few hours.

So what? Getting all of that to exist all in one go is a pretty tall order, no matter how long you've got. So how could the factory have just happened?

Chance? No.

To get the most basic living thing, the most basic cell, you would:

1. Have to have amino acids.  These just ‘happen’ to exist.
2. Then of the many different types, you'd have to isolate the 20 amino acids which are usable for making proteins.
3. Next, you'd have to go through them one by one picking out only the left-handed ones.
4. Then you'd have to assemble the amino acids in exactly the right sequence.
5. You would then have to join them to special peptide bonds that fold three-dimensionally.

If you hit the jackpot and got 100 amino acids in the right sequence, I am afraid you still would not have life – you would only have a measly, single protein. Another 200 or so proteins have to be formed and joined to even have the first glimmer of a chance of life.

Meanwhile, you would have to ensure that nothing interfered with your creation, because the chains of amino acids can be broken with a lot more ease than it takes to form them, so you would have to protect them somehow, and make sure nothing else reacted with them.

Basically, this process would need a designer.

Could DNA have just randomly happened? DNA is the design code. It is information, a code that tells the amino acids to arrange themselves in a special, complex sequence, creating proteins. A longer stretch of code is called a gene. DNA literally is the code of life, and would surely need an architect.

Look at it this way. I have a mobile, and I am going to send you a text message. There are 26 letters, plus some and punctuation to choose from.

I send you, 'AGGTTCTCCCAAGAGGTTCTCCCAAG'.

You'd think that it 'looks like a load of rubbish' (as if most text messages are not already). Stop being so hard on yourself. It is actually your nose.

It is a code. These letters are used as shorthand for the sequences of fragments of DNA e.g. CCAAGTAC. 

A = Adenine   T = Thymine – These two pair together
C = Cytosine   G = Guanine – These two pair together

These sequences are the code for genetic information. It is a genetic code that your body understands and reads. And a much longer code like that determines the shape of your nose, and what shape your children's noses will be. Now, I will send you another message.

'MAKE YOUR NOSE LIKE SIMON COWELL’S NOSE'

Would you look at that. How many intellectual concepts were involved in the creation of that message?

1. I have just communicated with you through a code called the English Language.
2. I assume you can read the code.
3. I assume you understand what a nose is.

That is what the A, C, G and T message was doing. Our body understands the ACGT code. And there is a rather rich individual somewhere in the world that is carrying out that message right now.

Now, let us imagine back at the dawn of time, perhaps billions of years ago, on a lonely, desolate planet there is a searing and hostile primitive soup all over the earth. No living thing exists, but for no comprehendible reason all these amino acids ‘happen’ to exist. But hang on, what is this? ... Look over there...wow! There is a single-celled organism that has got a code on it! The code is telling the organism to select amino acids in a special sequence so that the organism can reproduce itself. And, oh my goodness...look now: the code works! The cell's just divided and reproduced itself! That is very clever, and all without the chains being broken by the bubbling, hostile surface.

Now just how did the code come to exist? And how is the code understood? There is no reason why the ACGT sequence should make any more sense to the first cell that it did to you when you read it a minute ago. Where did the code and the means of translating it come from? They are both needed from the very start.  The code is useless without the understanding of what it says, and the understanding of what it says is useless without a code being there to read.

So, to use the analogy of the text message, if I left my mobile on the table forever, it would never write and send you that message all on its own. The letters are there on the keypad, but what use is that unless we introduce some intelligence? Once I pick up the mobile and start texting, that is like the message telling the amino acids lying around at the beginning of time on the primitive earth what order to get into. You have got to introduce intelligence to get any sense out of the letters!

You actually need a significant amount of intelligence. A two-month old baby could never send you a text message about Simon Cowell that is powerful enough to reproduce his nose. If the baby could get the phone to work at all, they would send you random gobbledegook. DNA code must have an information source. The phone is not the information. Did the phone think up the message? Of course not! The phone has no knowledge of what a nose is.

The point is that information-rich messages which can reproduce life do not just happen. It must have had some thinking behind it. When DNA arrives on the scene, it is an instruction manual. That looks suspiciously like forward planning.

On the 28th February 1953, Francis Crick walked into the Eagle Pub in Cambridge and proclaimed, "We have found the secret of life!" He and James Watson had just discovered the structure of DNA. Nobody knew what its structure was before. Some were sceptical about its existence. For the rest of his life, Crick insisted that DNA could not have just happened. It could not be formed by chance.

Why can the building blocks of life not have just organised themselves and created DNA?

Use a book for example. Any book. I have just randomly picked up the 'Ultimate Visual Dictionary 2001' as it was close at hand. Flick through it, and you see it is full of loads of pictures and writing.

Like the DNA code, this book is full of ordered information in a readable code. What caused this book to exist? Was it ( a ) the work of an intelligent author/authors, or ( b ) the result of a terrorist who blew up a Dorling Kindersley printing press causing ink to fall on paper in random ways, which happened to create a whole book of sequenced meaningful English sentences, pictures that are relevant to the writing on the page next to them, and a glossary at the back that allows you to look up the word ‘Neptune’ and find the page that has organised, and at the time correct, information regarding the planet Neptune? Not only that, but it happens on a massive scale, falling in exactly the same places on thousands of other pieces of paper.

You cannot seriously expect me to believe that ( b ) is the best explanation? Crick and many other scientists would today say ( b ) is such a remote chance that it is no chance.

The building blocks of life could not have organised themselves and created DNA. That is like saying the ink on the page is the author of the book! You would be saying the ink is intelligent enough to think up the storyline and then write the words, commas, sentences, spell everything and design the pictures that have are remarkably identical to the subject at hand.

Ink cannot do that...only an intelligent designer can do that, and I believe that intelligent designer is God.